NAME

Bio::Grep::Backends::GUUGle - GUUGle back-end

SYNOPSIS

  use Bio::Grep::Backends::GUUGle;
 
  # construct the GUUGle back-end       
  my $sbe = Bio::Grep::Backends::GUUGle->new();
 
  $sbe->settings->tmppath('tmp');
  $sbe->settings->datapath('data');
  
  # generate a GUUGle Bio::Grep database. you have to do this only once.
  # GUUGle does not create a persistent index right now.
  # This function generates an fast index for $sbe->get_sequences
  # and files with a description and the alphabet (only DNA/RNA allowed)
  $sbe->generate_database_out_of_fastafile('ATH1.cdna', 
     'AGI Transcripts (- introns, + UTRs)');
 
  my %local_dbs_description = $sbe->get_databases();
  my @local_dbs = sort keys %local_dbs_description;
 
  # take first available database in our test
  $sbe->settings->database($local_dbs[0]);
 
  my $seq = 'UGAACAGAAAGCUCAUGAGCC'; 
 
  # search for the reverse complement
  $sbe->settings->query($seq);
  $sbe->settings->reverse_complement(1);
  
  # display 5 bases upstream and downstream of the match
  $sbe->settings->upstream(5);
  $sbe->settings->downstream(5);
  
  $sbe->search();
 
  # output all informations we have!
  while ( my $res = $sbe->next_res ) {
     print $res->sequence->id . "\n";
     print $res->mark_subject_uppercase() . "\n";
     print $res->alignment_string() . "\n\n";
  }
   

DESCRIPTION

Bio::Grep::Backends::GUUGle searches for a query in a GUUGle suffix array.

NOTE 1: GUUGle always searches for the reverse complement. If you specify a query file, Bio::Grep throws an exception if reverse_complement is not set.

NOTE 2: GUUGle only allows search for exact matches. It counts GU as no mismatch.

METHODS

See Bio::Grep::Backends::BackendI for other methods.

Bio::Grep::Backends::GUUGle->new()
    This function constructs a GUUGle back-end object

   my $sbe = Bio::Grep::Backends::GUUGle->new();
$sbe->available_sort_modes()

Returns all available sort modes as hash. keys are sort modes, values a short description.

   $sbe->sort('ga');

Available sortmodes in GUUGle:

                ga  : 'ascending order of dG'
                gd  : 'descending order of dG'

Note that 'ga' and 'gd' require that search results have dG set. Bio::Grep::RNA ships with filters for free energy calculation. Also note that these two sort options require that we load all results in memory.

DIAGNOSTICS

See Bio::Grep::Backends::BackendI for other diagnostics.

Bio::Root::SystemException
  • It was not possible to run GUUGle in function search.

Bio::Root::BadParameter
GUUGle searches only for the reverse complement

You have specified a query_file and reverse_complement is not set.

settings->query_length not set. See -d flag...

You have specified a query_file and forgot to set query_length.

SEE ALSO

Bio::Grep::Backends::BackendI Bio::Grep::Container::SearchSettings Bio::Seq

AUTHOR

Markus Riester, <mriester@gmx.de>

LICENCE AND COPYRIGHT

Copyright (C) 2007 by M. Riester. All rights reserved.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.

DISCLAIMER OF WARRANTY

BECAUSE THIS SOFTWARE IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY FOR THE SOFTWARE, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE SOFTWARE "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE SOFTWARE IS WITH YOU. SHOULD THE SOFTWARE PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR, OR CORRECTION.

IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR REDISTRIBUTE THE SOFTWARE AS PERMITTED BY THE ABOVE LICENCE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE SOFTWARE (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE SOFTWARE TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.