LIMAONE
and 1 contributors

NAME

Bio::Grep::Backends::Agrep - Agrep back-end

SYNOPSIS

  use Bio::Grep::Backends::Agrep;
  
  use Error qw(:try);
  
  # configure our search back-end, in this case Agrep
  my $sbe = Bio::Grep::Backends::Agrep->new();
  
  $sbe->settings->execpath('/usr/bin');
  $sbe->settings->tmppath('tmp');
  $sbe->settings->datapath('data_agrep');
  
  # generate a database. you have to do this only once. 
  $sbe->generate_database_out_of_fastafile('ATH1.cdna', 'AGI Transcripts (- introns, + UTRs)');
  
  my %local_dbs_description = $sbe->get_databases();
  my @local_dbs = sort keys %local_dbs_description;
  
  # take first available database in our test
  $sbe->settings->database($local_dbs[0]);
  
  my $seq = 'UGAACAGAAAGCUCAUGAGCC'; 
  
  # search for the reverse complement and allow 4 mismatches
  $sbe->settings->query($seq);
  $sbe->settings->reverse_complement(1);
  $sbe->settings->mismatches(4);
  
  # things should be fast? then turn alignment calculation off
  $sbe->settings->no_alignments(1);
  
  # now try to search, agrep back-end will also throw an exception if no hit
  # was found
  try {
     $sbe->search();
  } catch Error::Simple with {
     my $E = shift;
     print  $E->{'-text'} . ' (' .  $E->{'-line'} . ")";
  };
  
  # output the searchresults with nice alignments
  while ( my $res = $sbe->next_res) {
     print $res->sequence->id . "\n";
     print $res->mark_subject_uppercase() . "\n";
     print $res->alignment_string() . "\n\n";
  }

DESCRIPTION

Bio::Grep::Backends::Agrep searches for a query with agrep.

METHODS

See Bio::Grep::Backends::BackendI for other methods.

Bio::Grep::Backends::Agrep->new()

This function constructs an agrep back-end object

   my $sbe = Bio::Grep::Backends::Agrep->new();
$sbe->available_sort_modes()

Returns all available sort modes as hash. keys are sort modes, values a short description.

Available sortmodes in Agrep:

       currently none.
       

DIAGNOSTICS

See Bio::Grep::Backends::BackendI for other diagnostics.

Bio::Root::SystemException

It was not possible to run agrep in function search. Check the search settings. Agrep returns also exit(1) if no hit was found!

Bio::Root::FileOpenException
In function search: It was not possible to open the database. Check permissions and paths.
In function generate_database_out_of_fastafile: It was not possible to write the database to disk. Check permissions and paths.
Bio::Root::IOException

It was not possible to write the database in generate_database_out_of_fastafile. Check free diskspace.

SEE ALSO

Bio::Grep::Backends::BackendI Bio::Grep::Container::SearchSettings Bio::SeqIO Bio::Index::Fasta

AUTHOR

Markus Riester, <mriester@gmx.de>

LICENCE AND COPYRIGHT

Based on Weigel::Seach v0.13

Copyright (C) 2005-2006 by Max Planck Institute for Developmental Biology, Tuebingen.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.

DISCLAIMER OF WARRANTY

BECAUSE THIS SOFTWARE IS LICENSED FREE OF CHARGE, THERE IS NO WARRANTY FOR THE SOFTWARE, TO THE EXTENT PERMITTED BY APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT HOLDERS AND/OR OTHER PARTIES PROVIDE THE SOFTWARE "AS IS" WITHOUT WARRANTY OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE SOFTWARE IS WITH YOU. SHOULD THE SOFTWARE PROVE DEFECTIVE, YOU ASSUME THE COST OF ALL NECESSARY SERVICING, REPAIR, OR CORRECTION.

IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MAY MODIFY AND/OR REDISTRIBUTE THE SOFTWARE AS PERMITTED BY THE ABOVE LICENCE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY GENERAL, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE USE OR INABILITY TO USE THE SOFTWARE (INCLUDING BUT NOT LIMITED TO LOSS OF DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD PARTIES OR A FAILURE OF THE SOFTWARE TO OPERATE WITH ANY OTHER SOFTWARE), EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF SUCH DAMAGES.